| Factor type | Xre |
|---|---|
| SWISS-PROT | P23789 |
| SubtiList | BG10994 |
| Consensus seq. | |
| Comment | repressor of a phage-like bacteriocin, PBSX (phibacin damaged-prophage) helix-turn-helix protein acts at the operator-promoter region |
| Link to | Phylogenetic profile , Weight matrix & Motif alignment |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| xkdB | ND | ND | Negative | 1321082..1321105 | (probably) around -20 | GATGATACAGAATGTATCGTTTAT |
GS, FT | McDonnell GE, et al. | 1994 |
| xkdB | ND | ND | Negative | 1321115..1321142 | (probably) around -20 | CATCCGATACAAAATGTATCAAAAAAGA |
GS, FT | McDonnell GE, et al. | 1994 |
| xre | ND | ND | Negative | 1321023..1321047 | (probably) around -20 | TTATAGATACAAAATGTATCAAAAT |
GS, FT | McDonnell GE, et al. | 1994 |
| xre | ND | ND | Negative | 1321049..1321076 | (probably) around -20 | AAGTTATGATAAAAAAAGTATCAAAAAT |
GS, FT | McDonnell GE, et al. | 1994 |