| Regulated Operon: | aldY | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| aldY | yxkE | + | 3985447..3986904 | aldehyde dehydrogenase | COG1012 | 
| Operon evidence: | upstream and downstream gene are on the opposite strand | 
|---|---|
| Reference: | Petersohn A, et al. (1999) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigB | Promoter | ND | 3985381..3985421 | ATTCGTTTACATATTGGCTTCAGCGGAAATAGAAGAAGACA | Petersohn A, et al. (1999): HB | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| CTAAATGAAAAAATCCCTCTGTTTCAAGTACAGAGGGATTTTTCTTTATTTAG >>>>>>>>> <<<<<<<<< | aldY | 


| 
 |