 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | bioWAFDBI-ytbQ |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| bioW | - | 3093728..3094507 | 6-carboxyhexanoate-CoA ligase | |||
| bioA | - | 3092392..3093738 | adenosylmethionine-8-amino-7-oxononanoate aminotransferase | COG0161 | x0337-BAC | |
| bioF | - | 3091233..3092402 | 8-amino-7-oxononanoate synthase | COG0156 | bioF-BAC | |
| bioD | - | 3090541..3091236 | dethiobiotin synthetase | COG0132 | ||
| bioB | - | 3089531..3090538 | biotin synthetase | COG0502 | ||
| bioI | - | 3088275..3089462 | cytochrome P450 enzyme | COG2124 | ||
| ytbQ | - | 3087437..3088042 | COG0451 |
| Operon evidence: | Northern blotting (7.0 kb transcript found by Bower et al.; 7.2 kb transcript found by Perkins et al.). |
|---|---|
| Reference: | Bower S, et al. (1996), Perkins JB, et al. (1996), Genbank AF008220 |
| Comments: | The readthrough terminator downstream of bioB leads to a 5.0 kb (as measured by Bower et al.) / 5.1 kb (as measured by Perkins et al.) bioWAFDB transcript. Readthrough termination was confirmed by Perkins et al. by deleting the stem-loop structure downstream of bioB. Perkins et al. also found a monocistronic bioW transcript of 0.8 kb, which may be an RNA degradation product. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| BirA | Negative | ND | 3094554..3094593 | CTAATTGTTAACCTTTGAATATAATTGGTTAACAATTTAG |
Bower S, et al. (1996): DB Perkins JB, et al. (1996): DB NB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAACGGAGCATAATCATTTTCTAAGATTATGCTCTTTTTCTTTTGTTAT >>>>>>>>>> <<<<<<<<<< |
ytbQ | |||
| AAAAGCAATCGGTATGATGTCGATTGTTTTTATTTTTGAAC >>>>>>>> <<<<<<<< |
bioB |
|