 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | Unique (biotin) |
|---|---|
| SWISS-PROT | P42975 |
| SubtiList | BG11206 |
| Consensus seq. | AATTGTTAACTTTG (plausible) |
| Comment | dual-purpose protein; acts as a repressor and has ligase activity |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| bioWAFDBI-ytbQ | bioW | SigA | Negative | 3094554..3094593 | None | CTAATTGTTAACCTTTGAATATAATTGGTTAACAATTTAG |
Bower S, et al. (1996): DB Perkins JB, et al. (1996): DB NB |
|