 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | cgeAB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| cgeA | cgeAA | + | 2147874..2148275 | |||
| cgeB | cgeAB | + | 2148282..2149235 | COG4641 |
| Operon evidence: | Northern blotting (1.4 kb transcript) |
|---|---|
| Reference: | Roels S & Losick R (1995) |
| Comments: | A shorter 1.0 kb transcript was also detected, which may be due to a terminator inside the cgeB coding region, or a processing or degradation product of the 1.4 kb transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| GerE | Positive | -72:-41 | 2147772..2147803 | AATAGATGAAAAATAGATCAGGTACGGCGTTC |
Roels S, et al. (1995): HB |
| GerE | Positive | -83:-52 | 2147761..2147792 | CATTTTCCTTAAATAGATGAAAAATAGATCAG |
Roels S, et al. (1995): HB |
| GerE | Positive | -100:-69 | 2147744..2147775 | CTCCATTAAAAAATCAGCATTTTCCTTAAATA |
Roels S, et al. (1995): HB |
| GerE | Positive | -126:-95 | 2147718..2147749 | TCGATTTATGGTATAGGCTATGTCCACTCCAT |
Roels S, et al. (1995): HB |
| GerE | Positive | -148:-117 | 2147696..2147727 | CTGTTTCACAATATGTGCGACTTCGATTTATG |
Roels S, et al. (1995): HB |
| SigK | Promoter | -43:+5 | 2147801..2147848 | TTCGACTCATACCAAATAACAGCCGGAAGAATATGAATAACGTGAGTT |
Roels S, et al. (1995): PE NB DB |
| YlbO | Positive | ND | ND | ND |
Kuwana R, et al. (2005): SDS NB DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAATCGTTCATTGCTATGAACGATTTTTTTATTCATAG >>>>>>>> <<<<<<<< |
cgeB |
|