Regulated Operon: | codV-clpQY-codY |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
codV | + | 1686487..1687401 | site-specific integrase/recombinase | COG4974 | codV-BAC | |
clpQ | hslV, codW | + | 1687414..1687959 | two-component ATP-dependent protease (N-terminal serine protease) | COG5405 | hslV-BAC hslV-BAC |
clpY | hslU, codX | + | 1687976..1689379 | two-component ATP-dependent protease (N-terminal serine protease) | COG1220 | clpY-BAC clpY-STA clpY-BAC clpY-STA hslU-LAB |
codY | + | 1689419..1690198 | transcriptional regulator | COG4465 | codY-BAC codY-STA x0200-STR |
Operon evidence: | plasmid integrations and in-frame deletion mutations |
---|---|
Reference: | Slack FJ, et al. (1995) |
Comments: |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
SigA | Promoter | -43:+6 | 1686420..1686468 | GTATTGATTGCAACCTGAGCGCGATTTGTGATACCATTTAAAAGCCCTT |
Slack FJ, et al. (1995): PE |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAAGAACCCTTTTTGAGGGTTCTTTTTTTATTTCAAA >>>>>>>> <<<<<<<< |
codY |
|