 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | csgA-ybxH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| csgA | + | 228054..228302 | sporulation-specific SASP protein | |||
| ybxH | + | 228319..228510 |
| Operon evidence: | Northern blotting (0.6 kb transcript) |
|---|---|
| Reference: | Shcheptov M, et al. (1997) |
| Comments: | terminator is inside the coding region of the downstream gene ybxI, which is transcribed in the opposite direction. The indicated stem-loop agrees better with the measured mRNA length than the terminator proposed in SubtiList. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigG | Promoter | ND | 227980..228033 | ATTTTTCGCGTATGGATTTTCCCTATTTTAGCAAGCTATAGGGTAAAGATAGCA |
Shchepetov M, et al. (1997): DB RG |
| SpoVT | Negative | ND | ND | ND |
Shchepetov M, et al. (1997): DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATTTAGAGCCCTGCCGTGCAGGGCTCTTTTATTTAGGATGT >>>>>>>>> <<<<<<<<< |
ybxH |
|