 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | degSU |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| degS | sacU | - | 3644409..3645566 | two-component sensor histidine kinase | COG4585 | |
| degU | sacU, iep | - | 3643637..3644326 | two-component response regulator | COG2197 |
| Operon evidence: | lacZ fusions |
|---|---|
| Reference: | Msadek T, et al. (1990), Soldo B, et al. (1996), Genbank U56901 |
| Comments: | The terminator downstream of degU suggests that the downstream yviA gene does not belong to this operon. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -52:+15 | 3645673..3645739 | ATTCGTACAGTCTTTAGAATTTTTGTGCGTATTTTGGTATCATAAAGAGTAGATAGTATATAAAAAT |
Msadek T, et al. (1990): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAGGAGACTTGCCTTTTACTAGGCAGGTCTTTTTTTAGGCTGCC >>>>>>>>> <<<<<<<<< |
degU |
|