 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | dhbACEBF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| dhbA | entA | - | 3290536..3291321 | 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase | COG1028 | |
| dhbC | - | 3289314..3290510 | isochorismate synthase | COG1169 | dhbC-BAC | |
| dhbE | entE | - | 3287666..3289285 | 2,3-dihydroxybenzoate-AMP ligase (enterobactin synthetase component E) | COG1021 | dhbE-BAC dhbE-BAC |
| dhbB | - | 3286700..3287638 | isochorismatase | COG3433 | dhbB-BAC | |
| dhbF | - | 3279544..3286680 |
| Operon evidence: | operon disruption |
|---|---|
| Reference: | Rowland BM, et al. (1996) |
| Comments: | operon disruption showed that at least the first four genes belong to the same operon |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| Fur | Negative | +7:+22 | 3291388..3291437 | TTATTTTTATAATTGATAATGATAATCATTATCAATAGATTGCGTTTTTC |
Baichoo N, et al. (2002): FT Ollinger J, et al. (2006): DB SDS-PAGE |
| SigA | Promoter | -39:+1 | 3291430..3291469 | ATATTTGACTGTCACATGACATTTGGATATGATTATTTTT |
Rowland BM & Taber HW (1996): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGAGACTGCTTGCCGCAGTCTCTTTTTCTATCTTACG >>>>>>>> <<<<<<<< |
dhbF |
|