 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | dps |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| dps | ytkB | - | 3135286..3135723 | DNA-protecting protein | COG0783 | dps-BAC x0191-STA |
| Operon evidence: | Northern blotting (0.5 kb transcript) |
|---|---|
| Reference: | Antelmann H, et al. (1997), Lapidus A, et al. (1997) |
| Comments: | A 1.2 kb transcript was also detected, which may have been a ytkA-dps transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigB | Promoter | -41:+3 | 3135740..3135783 | AAGAGGTTTTAGCGTACGATATTAAGGGTATACATAGTCATATA |
Antelmann H, et al. (1997): 2D-PAGE, NB PE DB |
| unknown | Promoter | -39:+6 | 3135750..3135794 | TAAGGGTAAAAAAGAGGTTTTAGCGTACGATATTAAGGGTATACA |
Antelmann H, et al. (1997): 2D-PAGE, NB PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAACGGCCGGATGTCTTAAAAAAGACGTCCGGCTTTTCTTTTTGTATC >>>>>>>>>>>> <<<<<<<<<<<< |
dps |
|