 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | fbp |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| fbp | fdp, yydE | + | 4127053..4129068 | fructose-1,6-bisphosphatase | COG3855 | x0209-STR |
| Operon evidence: | Northern blotting (2.4 kb transcript); upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Fujita Y, et al. (1998), BSORF |
| Comments: | Another putative terminator was found close to the stop codon; however, its location does not agree well with the Northern blotting result. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -46:+5 | 4127002..4127052 | GTTTTAATTGTCTCTAAAAGCAGTTATGCGGTACTATCATATAAAGGTCCA |
Fujita Y, et al. (1998): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAAAGTCCATTCTATATAACTCTCGCTAGGGTGGACCTTTTTCAACATTCAA >>>>>>>>>> <<<<<<<<<< |
fbp |
|