 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ftsH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ftsH | + | 76982..78895 | cell-division protein and general stress protein (class III heat-shock) | COG0465 | ftsH-BAC ftsH-CLO ftsH-LAB ftsH-STA ftsH-STR |
| Operon evidence: | Northern blotting (2.1 kb transcript) |
|---|---|
| Reference: | Deuerling E, et al. (1995) |
| Comments: | Northern blotting experiments in BSORF also show two longer transcripts, starting from the upstream hprT and yacA genes. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -42:+7 | 76910..76958 | ATTGTTTGTATTGGAATGATTTTCTATGGTACTATTGAACATAGTTGTG |
Deuerling E, et al. (1995): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACTGCCGGCTGACGCTGGCAGTTTTTTTATGTAAAT >>>>>>>> <<<<<<<< |
ftsH |
|