 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | gerAABC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| gerAA | + | 3389809..3391257 | yndD-BAC | |||
| gerAB | + | 3391226..3392323 | ||||
| gerAC | + | 3392320..3393441 |
| Operon evidence: | transcriptional fusions; upstream and downstream genes are in the opposite direction |
|---|---|
| Reference: | Zuberi AR, et al. (1987) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigF | Promoter | -39:+2 | 3389741..3389781 | CACAGTATATCATTTTTTTAACAGGAAAAGATAACCTCTAC |
Feavers IM, et al. (1990): RG PE |
| SigG | Promoter | -39:+2 | 3389741..3389781 | CACAGTATATCATTTTTTTAACAGGAAAAGATAACCTCTAC |
Feavers IM, et al. (1990): RG PE |
| SpoVT | Negative | ND | ND | ND |
Bagyan I, et al. (1996): DB |
|