 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | gerBABC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| gerBA | + | 3687842..3689290 | probable component of a germinant receptor | |||
| gerBB | + | 3689296..3690402 | probable component of a germinant receptor | |||
| gerBC | + | 3690399..3691523 |
| Operon evidence: | transcriptional integrations; upstream and downstream genes are transcribed in the opposite direction |
|---|---|
| Reference: | Corfe BM, et al. (1994), Presecan E, et al. (1997), Genbank Z92954 |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigG | Promoter | -43:+11 | 3687763..3687816 | TTTTCCTCGATAAGAATAATTCTCCTTTTTTGATACAAATTAATAAAAACCGTC |
Corfe BM, et al. (1994): PE |
| SpoVT | Negative | ND | ND | ND |
Bagyan I, et al. (1996): DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CAAAAGGGTGCGCATGATCGCGCACCCTTTTTTATGTTCCGA >>>>>>>> <<<<<<<< |
gerBC |
|