| Regulated Operon: | gerD | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| gerD | - | 158514..159071 | gerD-BAC | 
| Operon evidence: | upstream and downstream genes are transcribed in the opposite direction | 
|---|---|
| Reference: | Yon JR, et al. (1989) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigG | Promoter | -39:+20 | 159080..159138 | GTTATGTATAATTCCAAACAGATGAATCATATTAAAGGTAAGACAAGTATGTGAAAGGA | Kemp EH, et al. (1991): RG DB OV PE RO | 
| SpoVT | Positive | ND | ND | ND | Bagyan I, et al. (1996): DB | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| ATAAAGGGAAAGCCGGGATCTGGAATCCCGGTTCACCTTTTATACCTGCACT >>>>>>>>>>>>>> <<<<<<<<<<<<< | gerD | 


| 
 |