| Regulated Operon: | gerKACB | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| gerKA | + | 419678..421312 | gerKA-BAC | |||
| gerKC | + | 421302..422525 | ||||
| gerKB | + | 422550..423671 | 
| Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand | 
|---|---|
| Reference: | |
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigG | Promoter | -42:+12 | 419615..419668 | TAATGCATAATCTCAATTTTAAAAGGAAGAATATGAGAAAACGACAAGGAAAGG | Igarashi T & Setlow P (2006): 5'-RACE-PCR, RT-PCR, DB OV DP | 
| SpoVT | Negative | ND | ND | ND | Igarashi T & Setlow P (2006): RT-PCR, DB | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAAAAAATGATAAAAAGAGCGGGGGGATGCGGCCGCCGCTCTTTTTATGTTCACTT >>>>>>>> <<<<<<<<< | gerKB | 


| 
 |