 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | gyrA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| gyrA | nalA | + | 6993..9458 | DNA gyrase (subunit A) | COG0188 | gyrA-BAC gyrA-MYC gyrA-STA gyrA-STR |
| Operon evidence: | S1 nuclease experiments; Northern blotting |
|---|---|
| Reference: | Moriya S, et al. (1985), BSORF |
| Comments: | BSORF shows various transcripts in the gyrA region, all terminating at the same position downstream of gyrA. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -45:+19 | 6870..6933 | AGCAATTTAATGTGTATAATCATAAGTTTATTGATATAATGGAGAATAGTGAAATCGTATTGAA |
Ogasawara N, et al. (1985): S1 |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCGCAGCTGAAATAGCTGCGCTTTTTTGTGTCATAA >>>>>>>>> <<<<<<<<< |
gyrA |
|