Regulated Operon: | hxlAB |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
hxlA | yckG | - | 374725..375357 | 3-hexulose-6-phosphate synthase (HPS) | COG0269 | |
hxlB | yckF | - | 374162..374719 | 6-phospho-3-hexuloisomerase (PHI) | COG0794 |
Operon evidence: | Northern blotting (1.3 kb transcript found with hxlB probe; 1.5 kb transcript found with hxlA probe) |
---|---|
Reference: | Yasueda H, et al. (1999), Hanlon DW, et al. (1994), BSORF |
Comments: |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
HxlR | Positive | ND | 1891016..1891048 | CACCTATTAGTTTGTTGTTTAAACAAACTAACT |
Yasueda H, et al. (1999): NMR, GS |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
CACAACCGGCCTGAAGATCAGGCCGGTTTTATTTTTTCTAA >>>>>>>>> <<<<<<<<< |
hxlB |
|