Transcription factor: HxlR

Factor type ND
SWISS-PROT P42406
SubtiList BG11184
Consensus seq. ND
Comment positive regulator of hxlAB expression
Link to Phylogenetic profile

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
hxlAB hxlA None Positive 1891016..1891048 None CACCTATTAGTTTGTTGTTTAAACAAACTAACT Yasueda H, et al. (1999): NMR, GS




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai