 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ilvA-ypmP |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ilvA | - | 2291965..2293233 | threonine dehydratase | COG1171 | ilvA-BAC-1 ilvA-BAC-2 | |
| ypmP | - | 2291628..2291879 |
| Operon evidence: | Northern blotting (1.6 kb transcript) |
|---|---|
| Reference: | Mader U, et al. (2004) |
| Comments: | An internal promoter in front of ypmP leads to a 0.25 kb transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| CodY | Negative | ND | ND | ND |
Molle V, et al. (2003): AR Mader U, et al. (2004): NB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TTTTACCTGCATGCCCTCCTTTGTAATCGTTAATGGGGAGGCATGCAGGATTTTTTTTGCTCAGT >>>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<< |
ypmP |
|