 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | kinA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| kinA | spoIIF, spoIIJ, gsiC, scoB, scoD | + | 1469330..1471150 | two-component sensor histidine kinase | COG2202 |
| Operon evidence: | linearized/supercoiled templates; downstream gene is transcribed in the opposite direction |
|---|---|
| Reference: | Predich M, et al. (1992), Perego M, et al. (1989) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigH | Promoter | -42:+11 | 1469231..1469283 | TAAGAATAGAAGGAGAATACTCATTTTCTAGCGAATCATACTAGGTAAAAGTC |
Predich M, et al. (1992): PE, in vitro addition of E-SigH Antoniewski C, et al. (1990): RG |
| Spo0A | Negative | +13:+33 | 1469285..1469305 | ATCTGTATATGTCGAAACACG |
Fujita M, et al. (1998): GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AATAAAAACAACGGCTTAAACGCCGTTGTTTATCGTCTGCATT >>>>>>> <<<<<<< |
kinA |
|