| Regulated Operon: | lexA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| lexA | dinR | - | 1916848..1917465 | transcriptional regulator | COG1974 | lexA-BAC lexA-CLO lexA-LAB lexA-STA |
| Operon evidence: | upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Raymond-Denise A & Guillen N (1991) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| LexA | Negative | -44:-21 | 1917519..1917542 | TTTTTCGAACCTATGTTTGTACTG |
Raymond-Denise A & Guillen N (1991): DB RG Haijema BJ, et al. (1996): DB RG DP GS Winterling KW, et al. (1998): GS FT Au N, et al. (2005): GS AR DB |
| LexA | Negative | -72:-49 | 1917548..1917571 | ATATACGAACAAACGTTTCTGTCA |
Raymond-Denise A & Guillen N (1991): DB RG Haijema BJ, et al. (1996): DB RG DP GS Winterling KW, et al. (1998): GS FT Au N, et al. (2005): GS AR DB |
| LexA | Negative | -109:-86 | 1917585..1917608 | CAACAGGAATGTTTGTTCGCATTT |
Raymond-Denise A & Guillen N (1991): DB RG Haijema BJ, et al. (1996): DB RG DP GS Winterling KW, et al. (1998): GS FT Au N, et al. (2005): GS AR DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AATAACCCCCTCTTCCTTTACGGAGAGGGGGTTTGTTGTTCAAAAA >>>>>>>>>>> <<<<<<<<<< |
lexA |


|