Regulated Operon: | nucA-nin |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
nucA | comI | - | 371713..372156 | nuclease | nucA-BAC | |
nin | comJ | - | 371288..371686 |
Operon evidence: | Genome analysis |
---|---|
Reference: | Van Sinderen D, et al. (1995), Vosman B, et al. (1988) |
Comments: | BSORF also shows monocistronic nucA and nin transcripts. The second terminator was found inside the coding region of the downstream gene yckE. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
ComK | Positive | ND | 372269..372298 | CGTATTTTGCTGAAAACAAATATTTCGATC |
Van Sinderen D, et al. (1995): RG DB GS |
ComK | Positive | ND | 372245..372269 | CTGCTAAAATTACGATTTCTGCAAT |
Van Sinderen D, et al. (1995): RG DB GS |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAACCCCTGAGAGAATAACTCTCAGGGACTCTTTATAAACTTTC >>>>>>>>> <<<<<<<<< |
nin | |||
GTCCAATCCCAGTTGCTCGTTGTCAGATGCGGATTTTTTTTCGTTTTG >>>>>>>>>> <<<<<<<<<<<< |
nin |
|