| Regulated Operon: | ohrB | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ykzA | yzzE, ohrB | + | 1381326..1381736 | COG1764 | 
| Operon evidence: | Northern blotting (0.5 kb transcript) | 
|---|---|
| Reference: | Volker U, et al. (1998) | 
| Comments: | readthrough at this terminator leads to 0.8 kb and 1.4 kb transcripts | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigB | Promoter | -51:+5 | 1381249..1381304 | CTCGGCAAACATAGCATGTTTAAAAAGATCAGAAAGGGAAATATAACAACTAGATA | Volker U, et al. (1998): PE HM | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| ACCGGCATCCTGAGGATTCTCAGGATGTTTTTTGGTGTCGGA >>>>>>>>> <<<<<<<<< | ykzA | 


| 
 |