Regulated Operon: | parEC |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
parE | grlB | + | 1932686..1934653 | subunit of DNA topoisomerase IV | parE-BAC-2 parE-STA parE-STR | |
parC | grlA | + | 1934657..1937077 | subunit of DNA topoisomerase IV | COG0188 | parC-STR |
Operon evidence: | Genome analysis |
---|---|
Reference: | Au N, et al. (2005) |
Comments: |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
LexA | Negative | ND | 1932462..1932485 | ATAAACAAACATACGTTCTCATAG |
Au N, et al. (2005): GS AR DB |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
CATACAGAACAATAATAAAAAACCCGCTCATACTATATGAGCGGGTTTCGTTTGTTTTTT >>>>>>>>>> <<<<<<<<<< |
parC |
|