| Regulated Operon: | racA | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ywkC | racA | + | 3797812..3798366 | COG0789 | ywkC-BAC | 
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand | 
|---|---|
| Reference: | |
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigH | Promoter | ND | ND | ND | Ben-Yehuda S, et al. (2003): DB RG Wu LJ & Errington J (2003): DB Western blot | 
| Spo0A | Positive | ND | ND | ND | Ben-Yehuda S, et al. (2003): DB RG Wu LJ & Errington J (2003): DB Western blot | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| TTCAAATTTCAAACCTAAAGCAAAAAGCTCCCTTAAAGGGAGCTTTTTTTGTTACGCA >>>>>>> <<<<<<< | ywkC | 


| 
 |