 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | racA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ywkC | racA | + | 3797812..3798366 | COG0789 | ywkC-BAC |
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand |
|---|---|
| Reference: | |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigH | Promoter | ND | ND | ND |
Ben-Yehuda S, et al. (2003): DB RG Wu LJ & Errington J (2003): DB Western blot |
| Spo0A | Positive | ND | ND | ND |
Ben-Yehuda S, et al. (2003): DB RG Wu LJ & Errington J (2003): DB Western blot |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TTCAAATTTCAAACCTAAAGCAAAAAGCTCCCTTAAAGGGAGCTTTTTTTGTTACGCA >>>>>>> <<<<<<< |
ywkC |
|