 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | rsfA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| rsfA | ywfN, ipa-92r | + | 3860459..3861235 | probable transcriptional regulatory protein |
| Operon evidence: | upstream and downsteam genes are in the opposite direction |
|---|---|
| Reference: | Glaser P, et al. (1993) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| RsfA | Negative | ND | ND | ND |
Juan Wu L, et al. (2000): RG DB |
| SigF | Promoter | ND | ND | ND |
Juan Wu L, et al. (2000): RG DB OV |
| SigG | Promoter | ND | ND | ND |
Juan Wu L, et al. (2000): RG DB OV |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAATCCCAAAACGGGCAGCTGTTTTGGGATTTTCGCCATGTGCA >>>>>>>>>>> <<<<<<<<<<< |
rsfA |
|