 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | sacPA-ywdA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| sacP | ipa-49d | - | 3902669..3904054 | phosphotransferase system (PTS) sucrose-specific enzyme IIBC component | scrA-BAC | |
| sacA | ipa-50d | - | 3901230..3902672 | sucrase-6-phosphate hydrolase | COG1621 | |
| ywdA | ipa-51d | - | 3900888..3901136 |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Fouet A, et al. (1986), Debarbouille M, et al. (1990), Arnaud M, et al. (1992), Aymerich S & Steinmetz M (1992) |
| Comments: | In-vitro transcription experiments showed that transcription terminates at the stem-loop structure upstream of sacP; transcriptional termination is alleviated in the presence of sucrose by SacT (and to a lesser degree SacY) binding to the ribonucleic antiterminator (RAT) sequence. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SacT | Positive | +21:+63 | 3904140..3904182 | ATAAGCGGGATTGTGACTGGTAAAGCAGGCAAGACCTAAAATT |
Debarbouille M, et al. (1990): DB HM, sucrase activity Arnaud M, et al. (1992): SDM RG DB Arnaud M, et al. (1996): GS, in-vitro transcription |
| SacY | Positive | +21:+63 | 3904140..3904182 | ATAAGCGGGATTGTGACTGGTAAAGCAGGCAAGACCTAAAATT |
Arnaud M, et al. (1996): GS, in-vitro transcription |
| SigA | Promoter | -38:+13 | 3904190..3904240 | AAAAATAGTTGACGAAAACGCTATCATGATTTATGATGAAAGCGTATTCTT |
Arnaud M, et al. (1996): RO |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CAAGACCTAAAATTTGCGTAAATGAAAAAGGATCGCTGTGTCCTTTATTCGTTGGCGAATTTTAGGTCTTTTTT >>>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<< |
sacP | |||
| ACAGGCTGCCGATGGGATCGGCAGTTTTTTCTGTGAAAA >>>>>>>> <<<<<<<< |
ywdA |
|