 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | safA-coxA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| safA | yrbA | - | 2843900..2845063 | morphogenetic protein associated with SpoVID | COG1388 | |
| coxA | yrbB | - | 2843156..2843674 | spore cortex protein |
| Operon evidence: | Northern blotting (2.0 kb transcript) |
|---|---|
| Reference: | Takamatsu H, et al. (1999) |
| Comments: | Readthrough terminator downstream of safA, leading to a 1.2 kb safA monocistronic transcript. An internal promoter in front of coxA leads to a 0.7 kb coxA monocistronic transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigE | Promoter | -42:+4 | 2845116..2845161 | TCCTTTACTCATAACTTCTTTTGTTCAGGCATATGTTGTGAAGAAA |
Takamatsu H, et al. (1999): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GGAAGGGCTGCCGGAAGTGATATTCGGCAGCCTTTTTCTTTGCATCA >>>>>>>>>> <<<<<<<<<< |
coxA |
|