 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | senS |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| senS | + | 958626..958844 | transcriptional regulator |
| Operon evidence: | Terminator probe plasmid; upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | Genbank M34826, Wang LF & Doi RG (1990) |
| Comments: | Reporter gene fusions showed that the stemloop in front of senS can function as a antiterminator structure. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| AbrB | Negative | ND | ND | ND |
McCready P, et al. (1993): DB RG |
| SenS | Positive | ND | ND | ND |
Wang LF, et al. (1990): RO HB DB HM McCready P, et al. (1993): RG OV |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAACACCGAAGGCTCTTATCGTTTAGATAAGGGCCTTTTTTGTATGAAAA >>>>>>>>>> <<<<<<<<<< |
senS | |||
| AAAAACCCGCTGACTACAACGGGTTTTTGCATTTCTCC >>>>>>> <<<<<<< |
senS |
|