 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | sigL |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| sigL | - | 3511529..3512839 | RNA polymerase sigma-54 factor (sigma-L) | COG1508 |
| Operon evidence: | Genome analysis; downstream and upstream gene are on the opposite strand |
|---|---|
| Reference: | |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| CcpA | Negative | ND | 3512248..3512281 | AAAAAATGGAAAACGCTTTCAGTAGAGACGGGAA |
Choi SK, et al. (2005): SDM |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAGAAAGCGATATAAATAAAATCCTCCCTAGACGGGAGGATTTTTTTAAGGAATC >>>>>>> <<<<<<< |
sigL |
|