 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | spoIIIJ-jag |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| spoIIIJ | spo0J87 | - | 4212847..4213632 | COG0706 | x0809-BAC | |
| jag | - | 4212224..4212850 | SpoIIIJ-associated protein | COG1847 |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | Errington J, et al. (1992), BSORF |
| Comments: | Northern blotting results in BSORF also indicate the presence of a rpmH-rnpA-spoIIIJ-jag transcript. Primer extension experiments by Errington et al. also generated weak transcripts that originated from a promoter upstream of rnpA. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -44:+8 | 4213671..4213722 | GAAAAAGACACCATTTAAAACTGAAAGATGCTAAAATACATACAAGTATGCT |
Errington J, et al. (1992): PE RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAAAACCGAAGTCCGATAAAAATTGGATTTCGGTTTTTTTGTATCCGA >>>>>>>>>>>> <<<<<<<<<<<< |
jag |
|