 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | spoIVB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| spoIVB | - | 2518336..2519613 | serine peptidase of the SA clan | COG0750 |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | Van Hoy BE & Hoch JA (1990), BSORF |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigF | Promoter | -39:+3 | 2519667..2519708 | CAGTTATAAATAAGCCGTCAGAAGGCAAAATTAAATGATGTA |
Gomez M, et al. (1996): PE DB RG |
| SigG | Promoter | -39:+3 | 2519667..2519708 | CAGTTATAAATAAGCCGTCAGAAGGCAAAATTAAATGATGTA |
Gomez M, et al. (1996): PE DB RG |
| SpoVT | Positive | ND | ND | ND |
Bagyan I, et al. (1996): DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GCTGACTGCCGGAGTTTCCGGCAGTTTTTTTATTTTGAT >>>>>>>> <<<<<<<< |
spoIVB |
|