 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | spoVID-ysxE |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| spoVID | - | 2870087..2871814 | ||||
| ysxE | - | 2869029..2870054 |
| Operon evidence: | transcriptional fusion of ysxE with lacZ; Northern blotting of the downstream valS gene |
|---|---|
| Reference: | Beall B, et al. (1993), Wipat A, et al. (1996), Luo D, et al. (1997) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigE | Promoter | -39:+5 | 2871851..2871894 | CCACTCATATTTTCTCCAGTTCATACATACACCTTTAGTGACAT |
Beall B, et al. (1993): PE RG DB OV |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CGAAAGAGCTTTTCGTCCTTTTACAGGGATGAAGAGCTCTTTTTTCGTTCTCAG >>>>>>>>>>>>>> <<<<<<<<<<<<<< |
ysxE |
|