| Regulated Operon: | spoVR | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| spoVR | + | 1014927..1016333 | COG2719 | spoVR-BAC | 
| Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand | 
|---|---|
| Reference: | Beall B & Moran CP Jr (1994) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | -39:+4 | 1014865..1014907 | ACTATCATCTTTTGTCTGGCGGGCTCATACATTATAGATAAGT | Beall B & Moran CP Jr (1994): PE RG DB OV | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAAGAGGATGCAGCGTTCTGCATCCTTTTTATTTTCCAGT >>>>>>>> <<<<<<<< | spoVR | 


| 
 |