 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | spoVT |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| spoVT | yabL | + | 64097..64633 | transcriptional regulator | COG2002 | spoVT-BAC |
| Operon evidence: | insertional mutant |
|---|---|
| Reference: | Bagyan I, et al. (1996), Asai K, et al. (2001) |
| Comments: | An extensive extensive screening for transcripts in the region from rrnO to spo0H by Asai et al. revealed no transcripts containing spoVT and the downstream gene yabM. Transcription of the upstream mfd gene was found to continue into spoVT. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigG | Promoter | -37:+3 | 63977..64016 | GGTGTATATTACATTTGATGTGACGGATACTAATTTCAAG |
Bagyan I, et al. (1996): RG DB OV PE |
| SpoVT | Negative | ND | ND | ND |
Bagyan I, et al. (1996): DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GTAAAGAACAGCTCTCCTTGGGACGCTGTTCTTTTTCATGCGTGCC >>>>>>>>>>> <<<<<<<<<<<< |
spoVT |
|