| Regulated Operon: | sspD | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| sspD | - | 1413108..1413302 | small acid-soluble spore protein (alpha/beta-type SASP) | sspD-BAC | 
| Operon evidence: | downstream gene is transcribed in the opposite direction | 
|---|---|
| Reference: | Connors MJ, et al. (1986) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigG | Promoter | -39:+8 | 1413334..1413380 | GCCAGCATAAATAAACCCCGTATATTTCAAACTAAATACGCGTTAAG | Nicholson WL, et al. (1989): nuclease protection, RO | 
| SpoVT | Positive | ND | ND | ND | Bagyan I, et al. (1996): DB | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| TCTTTATTCGCCGGGGGCACTCGGCGAATCTTCATTTTTAGCTGA >>>>>>>>>> <<<<<<<<<< | sspD | 


| 
 |