 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | sspG-yurS |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| sspG | + | 3353093..3353239 | small acid-soluble spore protein | |||
| yurS | + | 3353239..3353514 |
| Operon evidence: | primer extension analysis of the downstream yurS gene; genes further downstream are on the opposite strand |
|---|---|
| Reference: | Bagyan I, et al. (1998) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| GerE | Positive | -99:-68 | 3352971..3353002 | TTACCAAATCAAATGCTTTCCTTCGACCTTTT |
Bagyan I, et al. (1998): DB RG |
| GerE | Positive | -63:-31 | 3353007..3353039 | TAATGTGGAAAAACCGCGAAGTTCGTCCAATCT |
Bagyan I, et al. (1998): DB RG |
| SigK | Promoter | -40:+3 | 3353030..3353072 | CGTCCAATCTCTTTACTCTCCTATCGAATATCCTGTCACTATC |
Bagyan I, et al. (1998): PE RG DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACCGCGGCCCCTCGGCCAGCGGTTTTTCTTCTGCATA >>>>>>>> <<<<<<<<< |
yurS |
|