| Regulated Operon: | sspK | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| sspK | - | 927448..927600 | small acid-soluble spore protein | 
| Operon evidence: | upstream and downstream genes are transcribed in the opposite direction | 
|---|---|
| Reference: | Cabrera-Hernandez & Setlow P (2000) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigG | Promoter | -41:+6 | 927648..927694 | TAACGCTTTATTACGTGGTGTTCTCCATATACTAACCTTACGTCTTC | Cabrera-Hernandez A & Setlow P (2000): PE | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAGAACAGCTGCATACACTGCAGCTGTTTTTTACCCTTTAT >>>>>>>> <<<<<<<< | sspK | 


| 
 |