| Regulated Operon: | sspN-tlp | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| sspN | + | 1929473..1929619 | small acid-soluble spore protein | |||
| tlp | + | 1929656..1929907 | small acid-soluble spore protein (thioredoxin-like protein) | 
| Operon evidence: | lacZ transcriptional fusion to tlp | 
|---|---|
| Reference: | Cabrera-Hernandez A, et al. (1999) | 
| Comments: | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigF | Promoter | -39:+3 | 1929419..1929460 | GTATTCATGTTTACCCCTCCTTTTGAGAAACCTATCTGTTGA | Cabrera-Hernandez A, et al. (1999): PE RG | 
| SigG | Promoter | -40:+13 | 1929419..1929471 | GTATTCATGTTTACCCCTCCTTTTGAGAAACCTATCTGTTGAGGAGGGATAAA | Cabrera-Hernandez A, et al. (1999): PE DB OV RG | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAAAACCAGGGAAACCTGGTTTTTTTCTTTCTGA >>>>> <<<<< | tlp | 


| 
 |