 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | thdF-gidAB-yyaA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| thdF | - | 4210534..4211913 | COG0486 | thdF-BAC thdF-STA thdF-STR | ||
| gidA | - | 4208627..4210513 | glucose-inhibited division protein | COG0445 | gidA-BAC gidA-STR | |
| gidB | - | 4207894..4208613 | glucose-inhibited division protein | COG0357 | gidB-BAC gidB-STR | |
| yyaA | - | 4206921..4207772 | COG1475 | yyaA-BAC |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | Sievers J, et al. (2002), BSORF |
| Comments: | Internal promoter and possibly a readthrough terminator are located upstream of yyaA. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ComK | Positive | ND | 4211972..4211993 | CAAACTATGTTATCTTTTAGTT |
Ogura M, et al. (2002): AR RG HM DB |
| ComK | Positive | ND | 4211950..4211972 | TTTGGCATAATAAAAATTTTTTT |
Ogura M, et al. (2002): AR RG HM DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAGAAGCTCTCCTGAAAAGCAGGAGAGCTTTTTATATTTTTAA >>>>>>>>> <<<<<<<<< |
yyaA |
|