| Regulated Operon: | tnrA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| tnrA | scgR | - | 1396719..1397051 | transcriptional regulator | COG0789 | tnrA-BAC |
| Operon evidence: | upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Genbank U55004 |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| TnrA | Positive | ND | 1397116..1397132 | TGTTAGAAAATATGACA |
Robichon D, et al. (2000): DE DP |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAAAAGTCCGGCTCGCAGTTGAGACGGACTTTTTACGTTTATAA >>>>>>>>> <<<<<<<<< |
tnrA |


|