 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | trpS |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| trpS | - | 1217426..1218418 | tryptophanyl-tRNA synthetase | COG0180 | trpS-BAC trpS-STA x0244-BAC |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Chow KC & Wong JT (1988), Condon C, et al. (1996) |
| Comments: | Transcriptional readthrough occurs at the stem-loop upstream of trpS if uncharged tryptophan tRNA binds to the T-box motif in the nascent mRNA transcript. The tRNA anticodon binds to the UGG codon in the sequence GAAUGGACU in the trpS leader mRNA. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| TrnD-Trp | Positive | ND | 1218494..1218517 | TGGAATAATCAGGGTGGTACCACG |
Condon C, et al. (1996): HM |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ACGCTAATCAAAAAACCGCTCTTTGCAAAGAGCGGTTTTTTTCAGTTGAC >>>>>>>> <<<<<<<< |
trpS | |||
| TGGTACCACGGTTCATTCGTCCCTTTTTTACAGGGGAAGAATGAGCCTTTTTTATTATGTTT >>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<< |
trpS |
|