 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | transfer RNA |
|---|---|
| SWISS-PROT | Q04385 |
| SubtiList | BG00057 |
| Consensus seq. | aANNaGGGTGGtACCgCG |
| Comment | Uncharged tRNA-Trp binds to the T-box sequence motif, promoting antitermination and transcriptional readthrough. |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| trpS | trpS | None | Positive | 1218494..1218517 | None | TGGAATAATCAGGGTGGTACCACG |
Condon C, et al. (1996): HM |
| rtpA-ycbK | yczA | SigA | Positive | 277018..277039 | None | TAATAAAGGTGGTACCGCGAGA |
Sarsero JP, et al. (2000): DB SDM, RNA dot blot analysis |
|