 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yacLMN |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yacL | + | 108671..109771 | COG4956 | yacL-BAC | ||
| yacM | + | 109786..110484 | COG1211 | |||
| yacN | + | 110477..110953 | COG0245 |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Petersohn A, et al. (1999) |
| Comments: | Northern blotting results in BSORF show several transcripts in the radA-yacKLMN region, some terminating at yacM and others at yacN. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigB | Promoter | -39:+3 | 108556..108597 | TTTCGGTTAAAACCTTATGAATACGGGTATATTAATGTTGGT |
Petersohn A, et al. (1999): HB PE |
|