Regulated Operon: | ydaDEFG |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
ydaD | + | 471267..472127 | COG1028 | yhdF-BAC-2 yhdF-BAC-3 | ||
ydaE | + | 472143..472646 | COG3822 | |||
ydaF | + | 472731..473282 | COG1670 | |||
ydaG | yzzA | + | 473360..473782 | COG3871 |
Operon evidence: | Northern blotting (2.8 kb and 3.3 kb transcripts) |
---|---|
Reference: | Petersohn A, et al. (1999) |
Comments: | The readthrough terminator downstream of ydaE leads to a 1.6 kb transcript. Both ydaDEFG transcripts terminate before reaching ydaH. An internal promoter in front of ydaG leads to monocistronic ydaG transcripts of 0.47 kb, 0.6 kb, and 0.9 kb. A 1.6 kb ydaFG transcript was also detected. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
SigB | Promoter | -40:+5 | 471197..471241 | AGCCATGTTTATCCAAAGAGTGTGTGAGGTACACAACAAATAGAC |
Petersohn A, et al. (1999): PE NB 2D-gel |
SigB | Promoter | -36:+4 | 473296..473335 | TTGTTTAAATCTTCCCCGGATGTGGAAAAGTAACAGCGGA |
Petersohn A, et al. (1999): PE NB 2D-gel |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
ACAAACCGCCCGGCGTACGCCGGACGGTTTTTTTATTGCAAA >>>>>>>>> <<<<<<<<< |
ydaG | |||
TATAAGGATGGCTTAACAGCCCATCCTTTTTGTATTGAAAA >>>>>>>> <<<<<<<<< |
ydaE |
|