 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ydbST |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ydbS | + | 512375..512854 | COG3402 | ydbS-BAC | ||
| ydbT | + | 512844..514325 | COG3428 |
| Operon evidence: | downstream gene is on the opposite strand |
|---|---|
| Reference: | Cao M, et al. (2002), Genbank AB001488 |
| Comments: | No experimental evidence that ydbS and ydbT belong to the same operon; Genbank AB001488 does not list a terminator after ydbT |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigW | Promoter | -38:+5 | 512310..512352 | AAGAATGAAACCTTTCTGTAAAAGAGACGTATAAATAACGACG |
Huang X, et al. (1999): S1 Cao M, et al. (2002): AR |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TCTGAAGCGGCGGTTAATACCGCCGCTCTTTTTTTTGCACGCA >>>>>>>>> <<<<<<<<< |
ydbT |
|