| Regulated Operon: | ydcA | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ydcA | - | 514577..515176 | COG0705 | 
| Operon evidence: | upstream and downstream genes are transcribed in the opposite direction | 
|---|---|
| Reference: | Eichenberger P, et al. (2003), Genbank AB001488 | 
| Comments: | No terminator listed in Genbank AB001488 | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigE | Promoter | -40:+7 | 515204..515250 | TACGTACTATTTAAATGGTTTGTCTCATAAACGTGTTACTATAGATA | Eichenberger P, et al. (2003): AR, 5'-RACE-PCR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| CAAAATCCTAAAATGGTTTTCATTTTAGGATTTTGTCATCTTTTC >>>>>>>>>>> <<<<<<<<<<< | ydcA | 


| 
 |