 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ydgGH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ydgG | + | 608478..608936 | COG1846 | |||
| ydgH | + | 608933..611590 | COG2409 |
| Operon evidence: | Genome analysis; upstream and doenstream genes are on the opposite strand |
|---|---|
| Reference: | Au N, et al. (2005) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| LexA | Negative | ND | 608346..608369 | ATACACGAACATGAGTTCTTATGT |
Au N, et al. (2005): GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CGAGAGAAGAGTGATGAATGGTCATCACTCTTTTTTCATGACTAA >>>>>>>>> <<<<<<<<< |
ydgH |
|