 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ydiOP |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ydiO | + | 654771..656054 | COG0270 | |||
| ydiP | + | 656076..657245 | COG0270 |
| Operon evidence: | Northern blotting (3.0 kb transcript) |
|---|---|
| Reference: | Ohshima H, et al. (2002), Genbank AB007637 |
| Comments: | The measured length of the mRNA transcript suggests that the upstream ydiN gene also belongs to this operon. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| LexA | Negative | ND | 654702..654725 | GATAAAGAACATTCGTTCTTGTAT |
Au N, et al. (2005): GS AR DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AGTATCGGAGCTGGATAAAACCAGCTCCGTTTTTTATCTTTAAT >>>>>>>>> <<<<<<<<< |
ydiP |
|